Skip to main content

pHS1929
(Plasmid #205968)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205968 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pColADuet-1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas8-HNH crRNA
  • gRNA/shRNA sequence
    GAGAAGTCATTTAATAAGGCCACTGTTAAAAA
  • Species
    Selenomonas sp. isolate RGIG9219 Water_deer_Rumen (MAG), JAGBLH010000220
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHS1929 was a gift from Feng Zhang (Addgene plasmid # 205968 ; http://n2t.net/addgene:205968 ; RRID:Addgene_205968)
  • For your References section:

    Uncovering the functional diversity of rare CRISPR-Cas systems with deep terascale clustering. Altae-Tran H, Kannan S, Suberski AJ, Mears KS, Demircioglu FE, Moeller L, Kocalar S, Oshiro R, Makarova KS, Macrae RK, Koonin EV, Zhang F. Science. 2023 Nov 24;382(6673):eadi1910. doi: 10.1126/science.adi1910. Epub 2023 Nov 23. 10.1126/science.adi1910 PubMed 37995242
Commonly requested with: