pHS1929
(Plasmid
#205968)
-
PurposeJAGBLH010000220 Cas8-HNH crRNA expression in pCOLADuet-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepColADuet-1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas8-HNH crRNA
-
gRNA/shRNA sequenceGAGAAGTCATTTAATAAGGCCACTGTTAAAAA
-
SpeciesSelenomonas sp. isolate RGIG9219 Water_deer_Rumen (MAG), JAGBLH010000220
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHS1929 was a gift from Feng Zhang (Addgene plasmid # 205968 ; http://n2t.net/addgene:205968 ; RRID:Addgene_205968) -
For your References section:
Uncovering the functional diversity of rare CRISPR-Cas systems with deep terascale clustering. Altae-Tran H, Kannan S, Suberski AJ, Mears KS, Demircioglu FE, Moeller L, Kocalar S, Oshiro R, Makarova KS, Macrae RK, Koonin EV, Zhang F. Science. 2023 Nov 24;382(6673):eadi1910. doi: 10.1126/science.adi1910. Epub 2023 Nov 23. 10.1126/science.adi1910 PubMed 37995242