Skip to main content

pBSII-PGK-FLPo-IRES-Puro
(Plasmid #205989)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205989 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescriptII SK+
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 6241
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PGK promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    500

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer M13F
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FLPo
  • Alt name
    optimized Flpo expression cassette
  • Insert Size (bp)
    1300
  • Entrez Gene
    flp
  • Promoter PGK promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aagaagaagaggaaggtgatgagc
  • 3′ sequencing primer AAGACGGCAATATGGTGGAA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    IRES-PuroR cassette
  • Alt name
    Internal ribosome entry site with Puromycin resistance gene
  • Insert Size (bp)
    574

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer ATCGAATTCCTGCAGCCC
  • 3′ sequencing primer M13R
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    FLPo insert from pDIRE (Addgene #26745)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBSII-PGK-FLPo-IRES-Puro was a gift from Sharon Torigoe (Addgene plasmid # 205989 ; http://n2t.net/addgene:205989 ; RRID:Addgene_205989)
  • For your References section:

    A suboptimal OCT4-SOX2 binding site facilitates the naive-state specific function of a Klf4 enhancer. Waite JB, Boytz R, Traeger AR, Lind TM, Lumbao-Conradson K, Torigoe SE. PLoS One. 2024 Sep 30;19(9):e0311120. doi: 10.1371/journal.pone.0311120. eCollection 2024. 10.1371/journal.pone.0311120 PubMed 39348365