Skip to main content
Addgene

pLINE1mORF1-ΔORF2-scFvFc
(Plasmid #206023)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206023 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCEP4
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse LINE1 vector harboring an scFv-Fc expression unit, encoding mutated ORF1 but lacking ORF2
  • Species
    H. sapiens (human), M. musculus (mouse), G. gallus (chicken)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer CCGACTGCATCTGCGTGTTC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLINE1mORF1-ΔORF2-scFvFc was a gift from Masamichi Kamihira (Addgene plasmid # 206023 ; http://n2t.net/addgene:206023 ; RRID:Addgene_206023)
  • For your References section:

    LINE-1 vectors mediate recombinant antibody gene transfer by retrotransposition in Chinese hamster ovary cells. Zheng F, Kawabe Y, Murakami M, Takahashi M, Nishihata K, Yoshida S, Ito A, Kamihira M. Biotechnol J. 2021 Jul;16(7):e2000620. doi: 10.1002/biot.202000620. Epub 2021 May 20. 10.1002/biot.202000620 PubMed 33938150