Skip to main content

pORF1
(Plasmid #206025)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206025 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZeoSV2(+)
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF1 derived from mouse LINE1
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TATTTATGCAGAGGCCGAGG
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORF1 was a gift from Masamichi Kamihira (Addgene plasmid # 206025 ; http://n2t.net/addgene:206025 ; RRID:Addgene_206025)
  • For your References section:

    LINE-1 vectors mediate recombinant antibody gene transfer by retrotransposition in Chinese hamster ovary cells. Zheng F, Kawabe Y, Murakami M, Takahashi M, Nishihata K, Yoshida S, Ito A, Kamihira M. Biotechnol J. 2021 Jul;16(7):e2000620. doi: 10.1002/biot.202000620. Epub 2021 May 20. 10.1002/biot.202000620 PubMed 33938150