Skip to main content

hVAMP3(1-77) S44E
(Plasmid #206030)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206030 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a(+)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Vesicle-associated membrane protein 3
  • Alt name
    VAMP3
  • Alt name
    Synaptobrevin 3
  • Alt name
    SYB3
  • Species
    H. sapiens (human)
  • Mutation
    changes serine 44 to glutamic acid
  • GenBank ID
    NM_004781.3
  • Entrez Gene
    VAMP3 (a.k.a. CEB)
  • Promoter T7
  • Tag / Fusion Protein
    • his-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic gene

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hVAMP3(1-77) S44E was a gift from Geert van den Bogaart (Addgene plasmid # 206030 ; http://n2t.net/addgene:206030 ; RRID:Addgene_206030)
  • For your References section:

    Phosphorylation of VAMP3 couples IL-6 Exocytosis to dendritic cell activation. Chen T, Psoma A, Mahajan S, Ter Beest M, Linders P, Franciosa G, Bianchi F, Bogaart GVD, Warner H. J Cell Sci. 2025 Sep 22:jcs.264139. doi: 10.1242/jcs.264139. 10.1242/jcs.264139 PubMed 40977280