pH2B-mNG2(11)
(Plasmid
#206043)
-
PurposePlasmid expressing a H2B-mNG2(11) fusion in mammalian cells for complementation with the mNG2(1-10) fragment.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepYTK089
- Backbone size w/o insert (bp) 1874
- Total vector size (bp) 7451
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH2B gene fused to the mNG2(11) fragment
-
Alt nameH2B-mNG2(11)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)435
- Promoter CMV
-
Tag
/ Fusion Protein
- H2B-mNG2(11)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ACGGTGGGAGGTCTATATAAGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.06.28.546942 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pH2B-mNG2(11) was a gift from Alisa Piekny (Addgene plasmid # 206043 ; http://n2t.net/addgene:206043 ; RRID:Addgene_206043) -
For your References section:
Endogenous tagging using split mNeonGreen in human iPSCs for live imaging studies. Husser MC, Pham NP, Law C, Araujo FRB, Martin VJJ, Piekny A. Elife. 2024 Apr 23;12:RP92819. doi: 10.7554/eLife.92819. 10.7554/eLife.92819 PubMed 38652106