Skip to main content
Addgene

cacna2d1 BBS pMT2
(Plasmid #206062)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206062 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT2
  • Backbone manufacturer
    Genetics Institute Inc
  • Backbone size w/o insert (bp) 5163
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna2d1
  • Alt name
    alpha2delta-1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3794
  • Entrez Gene
    Cacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
  • Promoter Ad MLP/TPL/SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
  • 3′ sequencing primer GGTCGAACCATGATGGCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kevin Campbell

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cacna2d1 BBS pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206062 ; http://n2t.net/addgene:206062 ; RRID:Addgene_206062)
  • For your References section:

    Rab11-dependent recycling of calcium channels is mediated by auxiliary subunit alpha(2)delta-1 but not alpha(2)delta-3. Meyer JO, Dolphin AC. Sci Rep. 2021 May 13;11(1):10256. doi: 10.1038/s41598-021-89820-1. 10.1038/s41598-021-89820-1 PubMed 33986433