Cav2.1 HA pCAGGS
(Plasmid #206076)

• Purpose: expression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and an exofacial double HA tag in domain II
• Depositing Lab: Annette Dolphin
• Publication: Raghib et al J Neurosci. 2001 Nov 1;21(21):8495-504.

Backbone

• Vector backbone: pCAGGS
• Backbone manufacturer: PMID 11397804
• Backbone size w/o insert (bp): 4890
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cacna1a
• Alt name: Cav2.1 alpha1A
• Species: R. norvegicus (rat)
• Insert Size (bp): 7598
• Entrez Gene: Cacna1a (a.k.a. BccA1, Cav2.1, rbA-1)
• Promoter: CMV/B-actin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (not destroyed)
• 5′ sequencing primer: CTCTGCTAACCATGTTCATGC
• 3′ sequencing primer: CTGATAGGCAGCCTGCACCTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Terry P. Snutch

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry