Cav2.2 BBS W391A pcDNA3
(Plasmid
#206077)
-
PurposeCav2.2 calcium channel with an exofacial double Bungarotoxin Binding Site motif in domain II and a mutation (W391A) in the ?1-interacting domain (AID) in the I-II loop that prevents Beta binding
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen Life Technologies
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1b
-
Alt nameCav2.2 alpha1B
-
SpeciesO. cuniculus (rabbit)
-
Insert Size (bp)7178
-
MutationW391A
-
Entrez GeneCACNA1B
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (not destroyed)
- 5′ sequencing primer CTGGCTAACTAGAGAACC
- 3′ sequencing primer GCATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYasuo Mori
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' end of DNA is very GC rich
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cav2.2 BBS W391A pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206077 ; http://n2t.net/addgene:206077 ; RRID:Addgene_206077) -
For your References section:
Functional exofacially tagged N-type calcium channels elucidate the interaction with auxiliary alpha2delta-1 subunits. Cassidy JS, Ferron L, Kadurin I, Pratt WS, Dolphin AC. Proc Natl Acad Sci U S A. 2014 Jun 17;111(24):8979-84. doi: 10.1073/pnas.1403731111. Epub 2014 Jun 2. 10.1073/pnas.1403731111 PubMed 24889613