Cav2.2 pCAGGS
(Plasmid
#206101)
-
Purposeexpression of rabbit Cav2.2 calcium channel, the 3'UTR is deleted, this enhances the expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerPMID 11397804
- Backbone size w/o insert (bp) 4890
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1b
-
Alt nameCav2.2 alpha1B
-
SpeciesO. cuniculus (rabbit)
-
Insert Size (bp)7094
-
Entrez GeneCACNA1B
- Promoter CMV/B-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTCTGCTAACCATGTTCATGC
- 3′ sequencing primer CTGATAGGCAGCCTGCACCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYasuo Mori
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' end of Cav2.2 DNA is very GC rich
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cav2.2 pCAGGS was a gift from Annette Dolphin (Addgene plasmid # 206101 ; http://n2t.net/addgene:206101 ; RRID:Addgene_206101) -
For your References section:
Dominant-negative calcium channel suppression by truncated constructs involves a kinase implicated in the unfolded protein response. Page KM, Heblich F, Davies A, Butcher AJ, Leroy J, Bertaso F, Pratt WS, Dolphin AC. J Neurosci. 2004 Jun 9;24(23):5400-9. doi: 10.1523/JNEUROSCI.0553-04.2004. 10.1523/JNEUROSCI.0553-04.2004 PubMed 15190113