cacnb1b pCAGGS
(Plasmid
#206102)
-
Purposeexpression of rat beta1b calcium channel auxillary subunit
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerPMID 11397804
- Backbone size w/o insert (bp) 4890
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacnb1b
-
Alt namebeta1b
-
SpeciesR. norvegicus (rat)
-
Entrez GeneCacnb1 (a.k.a. CAB1)
- Promoter CMV/B-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTCTGCTAACCATGTTCATGC
- 3′ sequencing primer CTGATAGGCAGCCTGCACCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTerry P. Snutch, Kevin Campbell: Pragnell et al. 1991 https://pubmed.ncbi.nlm.nih.gov/1657644/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacnb1b pCAGGS was a gift from Annette Dolphin (Addgene plasmid # 206102 ; http://n2t.net/addgene:206102 ; RRID:Addgene_206102)