cacna2d1 BBS pcDNA3
(Plasmid
#206106)
-
Purposeexpression of rat alpha2delta-1 calcium channel auxillary subunit with a single Bungarotoxin Binding Site motif inserted after aa549HA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206106 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen Life Technologies
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna2d1
-
Alt namealpha2delta-1
-
SpeciesR. norvegicus (rat)
-
Entrez GeneCacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTGGCTAACTAGAGAACC
- 3′ sequencing primer GCATTTAGGTGACACTATAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKevin Campbell
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cacna2d1 BBS pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206106 ; http://n2t.net/addgene:206106 ; RRID:Addgene_206106) -
For your References section:
Rab11-dependent recycling of calcium channels is mediated by auxiliary subunit alpha(2)delta-1 but not alpha(2)delta-3. Meyer JO, Dolphin AC. Sci Rep. 2021 May 13;11(1):10256. doi: 10.1038/s41598-021-89820-1. 10.1038/s41598-021-89820-1 PubMed 33986433