Skip to main content
Addgene

cacna2d1 HA pCAGGS
(Plasmid #206107)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206107 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone manufacturer
    PMID 11397804
  • Backbone size w/o insert (bp) 4890
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna2d1
  • Alt name
    alpha2delta-1
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Cacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
  • Promoter CMV/B-actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer CTGATAGGCAGCCTGCACCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kevin Campbell

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cacna2d1 HA pCAGGS was a gift from Annette Dolphin (Addgene plasmid # 206107 ; http://n2t.net/addgene:206107 ; RRID:Addgene_206107)
  • For your References section:

    Calcium currents are enhanced by alpha2delta-1 lacking its membrane anchor. Kadurin I, Alvarez-Laviada A, Ng SF, Walker-Gray R, D'Arco M, Fadel MG, Pratt WS, Dolphin AC. J Biol Chem. 2012 Sep 28;287(40):33554-66. Epub 2012 Aug 6. 10.1074/jbc.M112.378554 PubMed 22869375