pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
(Plasmid
#206178)
-
PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206178 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV2
- Backbone size w/o insert (bp) 2889
- Total vector size (bp) 5652
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCre
-
Alt nameCre Recombinase
-
gRNA/shRNA sequencemurine Lmna Exon10
- Promoter cTnT
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttgcctttctctccacagg
- 3′ sequencing primer cactggggaggggtcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byderived from Addgene #87682
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.18.549413v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA was a gift from Yuxuan Guo (Addgene plasmid # 206178 ; http://n2t.net/addgene:206178 ; RRID:Addgene_206178) -
For your References section:
Non-Cell-Autonomous Cardiomyocyte Regulation Complicates Gene Supplementation Therapy for Lmna-Associated Cardiac Defects in Mice. Sun Y, Guo C, Chen Z, Lin J, Yang L, Zhang Y, Wu C, Zhao D, Jardin B, Pu WT, Zhao M, Dong E, Hu X, Zhang S, Guo Y. JACC Basic Transl Sci. 2024 Aug 21;9(11):1308-1325. doi: 10.1016/j.jacbts.2024.06.004. eCollection 2024 Nov. 10.1016/j.jacbts.2024.06.004 PubMed 39619139