Skip to main content
Addgene

pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
(Plasmid #206178)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206178 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 2889
  • Total vector size (bp) 5652
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cre
  • Alt name
    Cre Recombinase
  • gRNA/shRNA sequence
    murine Lmna Exon10
  • Promoter cTnT

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tttgcctttctctccacagg
  • 3′ sequencing primer cactggggaggggtcac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Tnnt2-Cre-U6-Lmna-sgRNA was a gift from Yuxuan Guo (Addgene plasmid # 206178 ; http://n2t.net/addgene:206178 ; RRID:Addgene_206178)
  • For your References section:

    Non-Cell-Autonomous Cardiomyocyte Regulation Complicates Gene Supplementation Therapy for Lmna-Associated Cardiac Defects in Mice. Sun Y, Guo C, Chen Z, Lin J, Yang L, Zhang Y, Wu C, Zhao D, Jardin B, Pu WT, Zhao M, Dong E, Hu X, Zhang S, Guo Y. JACC Basic Transl Sci. 2024 Aug 21;9(11):1308-1325. doi: 10.1016/j.jacbts.2024.06.004. eCollection 2024 Nov. 10.1016/j.jacbts.2024.06.004 PubMed 39619139