139H2_HC
(Plasmid
#206201)
-
PurposeFor recombinant expression of the full heavy chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells. Includes a C-terminal -His8 tag for purification.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 5014
- Total vector size (bp) 6430
-
Modifications to backbone3' UTR altered, multiple cloning site altered
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-MUC1 antibody 139H2 heavy chain
-
Alt name139H2_HC
-
Alt nameIgG1 heavy chain
-
Alt nameIGHG1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1416
-
GenBank ID16017
-
Entrez GeneIghg1 (a.k.a. IgG1, Igh-4, VH7183)
- Promoter CMV
-
Tag
/ Fusion Protein
- -AAAHHHHHHHH (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GAAGAGGAAGAAAGGGAAAC
- 3′ sequencing primer CTGTAATTGACAGCCTTGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
139H2_HC was a gift from Joost Snijder (Addgene plasmid # 206201 ; http://n2t.net/addgene:206201 ; RRID:Addgene_206201) -
For your References section:
Reverse-engineering the anti-MUC1 antibody 139H2 by mass spectrometry-based de novo sequencing. Peng W, Giesbers KC, Siborova M, Beugelink JW, Pronker MF, Schulte D, Hilkens J, Janssen BJ, Strijbis K, Snijder J. Life Sci Alliance. 2024 Mar 20;7(6):e202302366. doi: 10.26508/lsa.202302366. Print 2024 Jun. 10.26508/lsa.202302366 PubMed 38508723