pBR BsmAIM Kan + p15A BsaIR Amp
(Plasmid
#206208)
-
PurposeContains two plasmids. Constitutive expression of BsmAIM and inducible expression of BsaIR
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneModified pCR2.1 TOPO (pBR BsmAIM Kan) and p15A origin plasmid (p15A BsaIR Amp)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsBoth Ampicillin and Kanamycin must be used to ensure selection for bacteria containing both plasmids.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBsamAIM and BsaIR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please take both plasmid sequences into account when performing sequencing and digest assays.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBR BsmAIM Kan + p15A BsaIR Amp was a gift from Andrew Ellington (Addgene plasmid # 206208 ; http://n2t.net/addgene:206208 ; RRID:Addgene_206208) -
For your References section:
Producing molecular biology reagents without purification. Bhadra S, Nguyen V, Torres JA, Kar S, Fadanka S, Gandini C, Akligoh H, Paik I, Maranhao AC, Molloy J, Ellington AD. PLoS One. 2021 Jun 1;16(6):e0252507. doi: 10.1371/journal.pone.0252507. eCollection 2021. 10.1371/journal.pone.0252507 PubMed 34061896