Skip to main content

pRTP801/TA-ODD
(Plasmid #206212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206212 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tetracycline-responsive transactivator fused with oxygen-dependent degradation domain
  • Alt name
    TA-ODD
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer AGGTGGAGAGAGAGACAGAGACAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRTP801/TA-ODD was a gift from Masamichi Kamihira (Addgene plasmid # 206212 ; http://n2t.net/addgene:206212 ; RRID:Addgene_206212)
  • For your References section:

    Hypoxia-responsive expression of vascular endothelial growth factor for induction of angiogenesis in artificial three-dimensional tissues. Masumoto S, Ono A, Ito A, Kawabe Y, Kamihira M. J Biosci Bioeng. 2021 Oct;132(4):399-407. doi: 10.1016/j.jbiosc.2021.06.010. Epub 2021 Aug 4. 10.1016/j.jbiosc.2021.06.010 PubMed 34364783