pDL22_Cas9-His Δcys E532C
(Plasmid
#206283)
-
PurposeBacterial expression of Cas9-His Δcys E532C variant under T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5190
- Total vector size (bp) 9387
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
Insert Size (bp)4101
-
MutationC80S, E532C, C574S
- Promoter T7
-
Tags
/ Fusion Proteins
- 6x-His (C terminal on insert)
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCaixia Gao lab. Addgene # 98158 (pET28a-Cas9-His)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDL22_Cas9-His Δcys E532C was a gift from Amit Choudhary (Addgene plasmid # 206283 ; http://n2t.net/addgene:206283 ; RRID:Addgene_206283) -
For your References section:
Engineering designer beta cells with a CRISPR-Cas9 conjugation platform. Lim D, Sreekanth V, Cox KJ, Law BK, Wagner BK, Karp JM, Choudhary A. Nat Commun. 2020 Aug 13;11(1):4043. doi: 10.1038/s41467-020-17725-0. 10.1038/s41467-020-17725-0 PubMed 32792475