Skip to main content

pDL25_Cas9-His Δcys E1207C
(Plasmid #206286)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206286 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5190
  • Total vector size (bp) 9387
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Insert Size (bp)
    4101
  • Mutation
    C80S, C574S, E1207C
  • Promoter T7
  • Tags / Fusion Proteins
    • 6x-His (C terminal on insert)
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Caixia Gao lab. Addgene # 98158 (pET28a-Cas9-His)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDL25_Cas9-His Δcys E1207C was a gift from Amit Choudhary (Addgene plasmid # 206286 ; http://n2t.net/addgene:206286 ; RRID:Addgene_206286)
  • For your References section:

    Engineering designer beta cells with a CRISPR-Cas9 conjugation platform. Lim D, Sreekanth V, Cox KJ, Law BK, Wagner BK, Karp JM, Choudhary A. Nat Commun. 2020 Aug 13;11(1):4043. doi: 10.1038/s41467-020-17725-0. 10.1038/s41467-020-17725-0 PubMed 32792475