AAV-Best1-Txnip(C247S_LL351-352AA)
(Plasmid
#206344)
-
PurposeAAV plasmid expressing mutant TXNIP in retinal pigment epithelium
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-Best1-WPRE-bGH
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTxnip
-
Alt nameVDUP1
-
Alt nameARRDC6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1194
-
MutationC247S, L351A, L352A
-
GenBank IDNM_001009935.2
- Promoter human Best1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTCCACAGGTGTCCAGGCATGGTGATGTTCAAGAAGAT
- 3′ sequencing primer ccagaggttgattGGATCCACTACTGCACGTTGTTGTTGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Best1-Txnip(C247S_LL351-352AA) was a gift from Connie Cepko (Addgene plasmid # 206344 ; http://n2t.net/addgene:206344 ; RRID:Addgene_206344) -
For your References section:
AAV-Txnip prolongs cone survival and vision in mouse models of retinitis pigmentosa. Xue Y, Wang SK, Rana P, West ER, Hong CM, Feng H, Wu DM, Cepko CL. Elife. 2021 Apr 13;10. pii: 66240. doi: 10.7554/eLife.66240. 10.7554/eLife.66240 PubMed 33847261