AAV-Best1-N.Txnip
(Plasmid
#206348)
-
PurposeAAV plasmid expressing deltion TXNIP in retinal pigment epithelium
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-Best1-WPRE-bGH
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTxnip
-
Alt nameVDUP1
-
Alt nameARRDC6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)687
-
MutationN terminal half (1-228aa)
-
GenBank IDNM_001009935.2
-
Entrez GeneTxnip (a.k.a. 1200008J08Rik, Hyplip1, THIF, Tbp-2, VDUP1)
- Promoter human Best1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTCCACAGGTGTCCAGGCATGGTGATGTTCAAGAAGAT
- 3′ sequencing primer ccagaggttgattGGATCCAttaGGTCTGGCCATTGGCAAGGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Best1-N.Txnip was a gift from Connie Cepko (Addgene plasmid # 206348 ; http://n2t.net/addgene:206348 ; RRID:Addgene_206348) -
For your References section:
Txnip deletions and missense alleles prolong the survival of cones in a retinitis pigmentosa mouse model. Xue Y, Zhou Y, Cepko CL. Elife. 2024 May 10;12:RP90749. doi: 10.7554/eLife.90749. 10.7554/eLife.90749 PubMed 38727583