Skip to main content
Addgene

pAP007
(Plasmid #206809)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206809 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-His6-MBP-TEV-LIC cloning vector (1M)
  • Backbone manufacturer
    Scott Gradia
  • Backbone size w/o insert (bp) 6465
  • Total vector size (bp) 9391
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BabSPARTA operon (6xHis-MBP-BabTIR-APAZ and BabAgo)
  • Alt name
    BabAgo
  • Species
    Bacillales bacterium
  • Insert Size (bp)
    4095
  • GenBank ID
    MBE3571068.1 MBE3571069.1
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-MBP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatgaagccctgaaagacgcgcag
  • 3′ sequencing primer tttgttagcagccggatctcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAP007 was a gift from Daan Swarts (Addgene plasmid # 206809 ; http://n2t.net/addgene:206809 ; RRID:Addgene_206809)
  • For your References section:

    Target DNA-dependent activation mechanism of the prokaryotic immune system SPARTA. Finocchio G, Koopal B, Potocnik A, Heijstek C, Westphal AH, Jinek M, Swarts DC. Nucleic Acids Res. 2024 Feb 28;52(4):2012-2029. doi: 10.1093/nar/gkad1248. 10.1093/nar/gkad1248 PubMed 38224450