pAP007
(Plasmid
#206809)
-
PurposepET-6xHis-MBP-TEV-BabTIR-APAZ/BabAgo - Heterologous BabSPARTA expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-His6-MBP-TEV-LIC cloning vector (1M)
-
Backbone manufacturerScott Gradia
- Backbone size w/o insert (bp) 6465
- Total vector size (bp) 9391
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBabSPARTA operon (6xHis-MBP-BabTIR-APAZ and BabAgo)
-
Alt nameBabAgo
-
SpeciesBacillales bacterium
-
Insert Size (bp)4095
-
GenBank IDMBE3571068.1 MBE3571069.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatgaagccctgaaagacgcgcag
- 3′ sequencing primer tttgttagcagccggatctcag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAP007 was a gift from Daan Swarts (Addgene plasmid # 206809 ; http://n2t.net/addgene:206809 ; RRID:Addgene_206809) -
For your References section:
Target DNA-dependent activation mechanism of the prokaryotic immune system SPARTA. Finocchio G, Koopal B, Potocnik A, Heijstek C, Westphal AH, Jinek M, Swarts DC. Nucleic Acids Res. 2024 Feb 28;52(4):2012-2029. doi: 10.1093/nar/gkad1248. 10.1093/nar/gkad1248 PubMed 38224450