Skip to main content

pcDNA3.1+FLAG-KrasnatG12D
(Plasmid #206842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206842 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1+
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6020
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kras
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    621
  • Mutation
    changed Glycine 12 to Aspartic Acid
  • GenBank ID
    NM_001403240.1
  • Entrez Gene
    Kras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Thermo Gene ART Gene Synthesis

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1+FLAG-KrasnatG12D was a gift from Christopher Counter (Addgene plasmid # 206842 ; http://n2t.net/addgene:206842 ; RRID:Addgene_206842)
  • For your References section:

    Genetically manipulating endogenous Kras levels and oncogenic mutations in vivo influences tissue patterning of murine tumorigenesis. Le Roux O, Pershing NLK, Kaltenbrun E, Newman NJ, Everitt JI, Baldelli E, Pierobon M, Petricoin EF, Counter CM. Elife. 2022 Sep 7;11:e75715. doi: 10.7554/eLife.75715. 10.7554/eLife.75715 PubMed 36069770