Skip to main content

pBabePuro-FLAG-KrasnatG12D
(Plasmid #206865)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206865 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBabePuro
  • Backbone size w/o insert (bp) 5086
  • Total vector size (bp) 5678
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kras
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    621
  • Mutation
    changed Glycine 12 to Aspartic Acid
  • GenBank ID
    NM_001403240.1
  • Entrez Gene
    Kras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ctttatccagccctcac
  • 3′ sequencing primer CCCTAACTGACACACATTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabePuro-FLAG-KrasnatG12D was a gift from Christopher Counter (Addgene plasmid # 206865)
  • For your References section:

    Genetically manipulating endogenous Kras levels and oncogenic mutations in vivo influences tissue patterning of murine tumorigenesis. Le Roux O, Pershing NLK, Kaltenbrun E, Newman NJ, Everitt JI, Baldelli E, Pierobon M, Petricoin EF, Counter CM. Elife. 2022 Sep 7;11:e75715. doi: 10.7554/eLife.75715. 10.7554/eLife.75715 PubMed 36069770