pcDNA3.1_hHNF4alpha
(Plasmid
#206878)
-
PurposeThe ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the Bam HI/XbaI sites of the pcDNA3.1(+), the mammalian expression vector.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6853
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman hepatocyte nuclear factor 4 alpha
-
Alt nameHNF4alpha variant 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1425
-
GenBank IDNM_000457
-
Entrez GeneHNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer ttggatccgccaccatgcgactctccaaaaccc
- 3′ sequencing primer tttctagactagataacttcctgcttgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Zolfaghari R, Bonzo JA, Gonzalez FJ, Ross AC. Hepatocyte Nuclear Factor 4α (HNF4α) Plays a Controlling Role in Expression of the Retinoic Acid Receptor β (RARβ) Gene in Hepatocytes. Int J Mol Sci. 2023 May 11;24(10):8608. doi: 10.3390/ijms24108608. PMID: 37239961; PMCID: PMC10218549.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_hHNF4alpha was a gift from Catharine Ross & Reza Zolfaghari (Addgene plasmid # 206878 ; http://n2t.net/addgene:206878 ; RRID:Addgene_206878) -
For your References section:
Hepatocyte nuclear factor 4alpha (HNF4alpha) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. Zolfaghari R, Ross AC. J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839. 10.1002/jcb.24839 PubMed 24819304