Skip to main content

pcDNA3.1_hHNF4alpha
(Plasmid #206878)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206878 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6853
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human hepatocyte nuclear factor 4 alpha
  • Alt name
    HNF4alpha variant 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1425
  • GenBank ID
    NM_000457
  • Entrez Gene
    HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer ttggatccgccaccatgcgactctccaaaaccc
  • 3′ sequencing primer tttctagactagataacttcctgcttgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Zolfaghari R, Bonzo JA, Gonzalez FJ, Ross AC. Hepatocyte Nuclear Factor 4α (HNF4α) Plays a Controlling Role in Expression of the Retinoic Acid Receptor β (RARβ) Gene in Hepatocytes. Int J Mol Sci. 2023 May 11;24(10):8608. doi: 10.3390/ijms24108608. PMID: 37239961; PMCID: PMC10218549.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_hHNF4alpha was a gift from Catharine Ross & Reza Zolfaghari (Addgene plasmid # 206878 ; http://n2t.net/addgene:206878 ; RRID:Addgene_206878)
  • For your References section:

    Hepatocyte nuclear factor 4alpha (HNF4alpha) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. Zolfaghari R, Ross AC. J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839. 10.1002/jcb.24839 PubMed 24819304