px-458-sgRNA-IF1
(Plasmid
#206923)
-
PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell lines
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx458
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9289
- Total vector size (bp) 9292
-
Vector typeCRISPR
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsIn LB medium
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting IF1 (ATPase inhibitory factor 1)
-
gRNA/shRNA sequencegcagtccgagaatgtcgaccg
-
SpeciesH. sapiens (human)
-
GenBank IDNC_000001.11
-
Entrez GeneATP5IF1 (a.k.a. ATPI, ATPIF1, ATPIP, IP)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA sequence (gcagtccgagaatgtcgaccg) differs from that listed in the original publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px-458-sgRNA-IF1 was a gift from José Cuezva (Addgene plasmid # 206923 ; http://n2t.net/addgene:206923 ; RRID:Addgene_206923) -
For your References section:
IF1 promotes oligomeric assemblies of sluggish ATP synthase and outlines the heterogeneity of the mitochondrial membrane potential. Romero-Carraminana I, Esparza-Molto PB, Dominguez-Zorita S, Nuevo-Tapioles C, Cuezva JM. Commun Biol. 2023 Aug 12;6(1):836. doi: 10.1038/s42003-023-05214-1. 10.1038/s42003-023-05214-1 PubMed 37573449