pIF1-GFP
(Plasmid
#206925)
-
PurposePlasmid expressing human IF1 fused in C-terminal with GFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP_C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5093
- Total vector size (bp) 6093
-
Vector typeMammalian Expression
-
Selectable markersBleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrown in LB medium
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman IF1 (ATPase inhibitory factor 1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1000
-
GenBank IDNC_000001.11
-
Entrez GeneATP5IF1 (a.k.a. ATPI, ATPIF1, ATPIP, IP)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIF1-GFP was a gift from José Cuezva (Addgene plasmid # 206925 ; http://n2t.net/addgene:206925 ; RRID:Addgene_206925) -
For your References section:
IF1 promotes oligomeric assemblies of sluggish ATP synthase and outlines the heterogeneity of the mitochondrial membrane potential. Romero-Carraminana I, Esparza-Molto PB, Dominguez-Zorita S, Nuevo-Tapioles C, Cuezva JM. Commun Biol. 2023 Aug 12;6(1):836. doi: 10.1038/s42003-023-05214-1. 10.1038/s42003-023-05214-1 PubMed 37573449