pcDNA3.1_hMed25
(Plasmid
#206958)
-
PurposeThe ORF of human Med25 cDNA amplified from the RT human liver RNA was cloned into pGEMTE vector and then subclone at XhoI/XbaI sites of the pcDNA3.2(+), the mammalian expression vector.
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 7760
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomo sapiens mediator complex subunit 25 (MED25), transcript variant 1, mRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2332
-
GenBank IDNM_030973 NM_030973
-
Entrez GeneMED25 (a.k.a. ACID1, ARC92, BVSYS, CMT2B2, P78, PTOV2, TCBAP0758)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer atctcgagccgccaccatggtccccgggtccgag
- 3′ sequencing primer attctagactagatgagatccatgaggatg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_hMed25 was a gift from Catharine Ross & Reza Zolfaghari (Addgene plasmid # 206958 ; http://n2t.net/addgene:206958 ; RRID:Addgene_206958)