Skip to main content

pcDNA3.1_hMed25
(Plasmid #206958)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206958 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 7760
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens mediator complex subunit 25 (MED25), transcript variant 1, mRNA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2332
  • GenBank ID
    NM_030973 NM_030973
  • Entrez Gene
    MED25 (a.k.a. ACID1, ARC92, BVSYS, CMT2B2, P78, PTOV2, TCBAP0758)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer atctcgagccgccaccatggtccccgggtccgag
  • 3′ sequencing primer attctagactagatgagatccatgaggatg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1_hMed25 was a gift from Catharine Ross & Reza Zolfaghari (Addgene plasmid # 206958 ; http://n2t.net/addgene:206958 ; RRID:Addgene_206958)