pML33
(Plasmid
#206996)
-
PurposeContains OsTiR1 ORF and LoxP and Lox2272 sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206996 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep2Lox
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOsTiR1
-
SpeciesOryza sativa
-
Insert Size (bp)1728
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer TGGTGTCGATAACTTCGTATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML33 was a gift from Eugene Makeyev (Addgene plasmid # 206996 ; http://n2t.net/addgene:206996 ; RRID:Addgene_206996) -
For your References section:
Protocol for auxin-inducible depletion of the RNA-binding protein PTBP1 in mouse embryonic stem cells. Kainov Y, Zhuravskaya A, Makeyev EV. STAR Protoc. 2023 Oct 18;4(4):102644. doi: 10.1016/j.xpro.2023.102644. 10.1016/j.xpro.2023.102644 PubMed 37862173