NBS1-Halo HRD
(Plasmid
#207084)
-
PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous NBS1 locus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac dual
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag followed by a LoxP-PuroR cassette flanked by human NBS1 locus sequences
-
SpeciesH. sapiens (human), Synthetic
- Promoter None
-
Tags
/ Fusion Proteins
- HaloTag (C terminal on insert)
- HaloTag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTTAAAAAACCTCCCACACCTC
- 3′ sequencing primer AAA CCA CAA CTA GAA TGC AGT GA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NBS1-Halo HRD was a gift from Jens Schmidt (Addgene plasmid # 207084 ; http://n2t.net/addgene:207084 ; RRID:Addgene_207084) -
For your References section:
Systematic analysis of the molecular and biophysical properties of key DNA damage response factors. Heyza JR, Mikhova M, Bahl A, Broadbent DG, Schmidt JC. Elife. 2023 Jun 21;12:e87086. doi: 10.7554/eLife.87086. 10.7554/eLife.87086 PubMed 37341699