-
PurposeFusion of Ca2+ reporter and lysosomal Ca2+-permeable channel, with ER-export signal
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDendra2-N
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6987
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMcoln1
-
Alt nameTRPML1, Mucolipin1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1740
-
GenBank IDNM_020533
-
Entrez GeneMCOLN1 (a.k.a. LECD, MG-2, ML1, ML4, MLIV, MST080, MSTP080, TRP-ML1, TRPM-L1, TRPML1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- G-GECO1.2 (C terminal on insert)
- ER-Export Signal (ERES) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRPML1-G-GECO1.2-ERES was a gift from Antony Galione (Addgene plasmid # 207144 ; http://n2t.net/addgene:207144 ; RRID:Addgene_207144) -
For your References section:
NAADP-regulated two-pore channels drive phagocytosis through endo-lysosomal Ca(2+) nanodomains, calcineurin and dynamin. Davis LC, Morgan AJ, Galione A. EMBO J. 2020 Jul 15;39(14):e104058. doi: 10.15252/embj.2019104058. Epub 2020 Jun 8. 10.15252/embj.2019104058 PubMed 32510172