Skip to main content

pFUW-TetO-Egr2
(Plasmid #207188)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207188 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUW-TetO
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pFUW-TetO-EGR2
  • Species
    H. sapiens (human)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site BstBI (unknown if destroyed)
  • 5′ sequencing primer TCCACGCTGTTTTGACCTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUW-TetO-Egr2 was a gift from Filipe Pereira (Addgene plasmid # 207188 ; http://n2t.net/addgene:207188 ; RRID:Addgene_207188)
  • For your References section:

    Anchored screening identifies transcription factor blueprints underlying dendritic cell diversity and subset-specific anti-tumor immunity. Henriques-Oliveira L, Altman AR, Kurochkin I, Ascic E, Halitzki E, Matei A, Pértiga-Cabral D, Ulmert I, Holst S, Nair MS, Cunha PP, Park S, Vergani S, Kharas MG, Yuan J, Lahl K, Rosa FF, Pires CF, Pereira C-F. Immunity. 58, 1-20. October 2025. 10.1016/j.immuni.2025.08.001