Dox-SOScat
(Plasmid
#207329)
-
PurposePiggyBac vector backbone encoding doxycycline-inducible expression of membrane-localized catalytic domain of SOS (SOScat)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207329 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePiggyBac
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 3093
- Total vector size (bp) 10199
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameson of sevenless homolog 2 variant, catalytic domain
-
Alt nameSOScat
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1461
-
Mutationrange: 593 to 1078
- Promoter Tet Response Element
-
Tag
/ Fusion Protein
- myristoylation tag - BFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGTCGACTAGTCCAGTGTG
- 3′ sequencing primer CCCACTGACGGGCACCGGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dox-SOScat was a gift from Jared Toettcher (Addgene plasmid # 207329 ; http://n2t.net/addgene:207329 ; RRID:Addgene_207329) -
For your References section:
Control of gastruloid patterning and morphogenesis by the Erk and Akt signaling pathways. Underhill EJ, Toettcher JE. Development. 2023 Aug 15;150(16):dev201663. doi: 10.1242/dev.201663. Epub 2023 Aug 17. 10.1242/dev.201663 PubMed 37590131