Skip to main content
Addgene

Thy1 promoter construct
(Plasmid #20736)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20736 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTS(2)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Thy1 promoter
  • Alt name
    Thy-1.2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6500
  • GenBank ID
  • Entrez Gene
    Thy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site PvuI (unknown if destroyed)
  • 5′ sequencing primer Thy1F1 (TCTGAGTGGCAAAGGACCTTAGG)
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains 6.5 kb of the murine thy1.2 gene, extending from the promoter to the intron following exon 4, but lacking exon 3 and its flanking introns (see Figure 1 in Caroni 1997).

P. Caroni, Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J. Neurosci. Methods 71 (1997), pp. 3–9 https://www.ncbi.nlm.nih.gov/pubmed/9125370

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy1 promoter construct was a gift from Joshua Sanes (Addgene plasmid # 20736 ; http://n2t.net/addgene:20736 ; RRID:Addgene_20736)
  • For your References section:

    Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM, Lichtman JW, Sanes JR. Neuron. 2000 Oct . 28(1):41-51. 10.1016/S0896-6273(00)00084-2 PubMed 11086982