-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTS(2)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThy1 promoter
-
Alt nameThy-1.2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6500
-
GenBank ID
-
Entrez GeneThy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site PvuI (unknown if destroyed)
- 5′ sequencing primer Thy1F1 (TCTGAGTGGCAAAGGACCTTAGG)
- 3′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byPico Caroni, FMI
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains 6.5 kb of the murine thy1.2 gene, extending from the promoter to the intron following exon 4, but lacking exon 3 and its flanking introns (see Figure 1 in Caroni 1997).
P. Caroni, Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J. Neurosci. Methods 71 (1997), pp. 3–9 https://www.ncbi.nlm.nih.gov/pubmed/9125370
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Thy1 promoter construct was a gift from Joshua Sanes (Addgene plasmid # 20736 ; http://n2t.net/addgene:20736 ; RRID:Addgene_20736) -
For your References section:
Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM, Lichtman JW, Sanes JR. Neuron. 2000 Oct . 28(1):41-51. 10.1016/S0896-6273(00)00084-2 PubMed 11086982