Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Thy1 promoter construct
(Plasmid #20736)


Item Catalog # Description Quantity Price (USD)
Plasmid 20736 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    Thy1 promoter
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Thy1 (a.k.a. CD90, T25, Thy-1, Thy-1.2, Thy1.1, Thy1.2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site PvuI (unknown if destroyed)
  • 5′ sequencing primer Thy1F1 (TCTGAGTGGCAAAGGACCTTAGG)
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Pico Caroni, FMI
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

Contains 6.5 kb of the murine thy1.2 gene, extending from the promoter to the intron following exon 4, but lacking exon 3 and its flanking introns (see Figure 1 in Caroni 1997).

P. Caroni, Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J. Neurosci. Methods 71 (1997), pp. 3–9

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Thy1 promoter construct was a gift from Joshua Sanes (Addgene plasmid # 20736 ; ; RRID:Addgene_20736)
  • For your References section:

    Imaging neuronal subsets in transgenic mice expressing multiple spectral variants of GFP. Feng G, Mellor RH, Bernstein M, Keller-Peck C, Nguyen QT, Wallace M, Nerbonne JM, Lichtman JW, Sanes JR. Neuron. 2000 Oct . 28(1):41-51. 10.1016/S0896-6273(00)00084-2 PubMed 11086982