pSmart-EF1alpha-AcrIE2-NLS
(Plasmid
#207396)
-
PurposeExpresses AcrIE2 with NLS in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207396 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSmart HC Kan
-
Backbone manufacturerLucigen
- Backbone size w/o insert (bp) 1993
- Total vector size (bp) 3678
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a-AcrIE2-bGH polyA
-
Insert Size (bp)1685
- Promoter EF1a
-
Tag
/ Fusion Protein
- NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttgccctttttgagtttgg
- 3′ sequencing primer gctggcaactagaaggcaca
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSmart-EF1alpha-AcrIE2-NLS was a gift from Yan Zhang (Addgene plasmid # 207396 ; http://n2t.net/addgene:207396 ; RRID:Addgene_207396) -
For your References section:
Exploiting activation and inactivation mechanisms in type I-C CRISPR-Cas3 for genome-editing applications. Hu C, Myers MT, Zhou X, Hou Z, Lozen ML, Nam KH, Zhang Y, Ke A. Mol Cell. 2024 Feb 1;84(3):463-475.e5. doi: 10.1016/j.molcel.2023.12.034. Epub 2024 Jan 18. 10.1016/j.molcel.2023.12.034 PubMed 38242128