pS34.EF1α<GFP-2A-Cas9-RC
(Plasmid
#207404)
-
PurposeCas9-RC and GFP from an EF1α promoter. High-performance knockin through DSB repair by homology-directed recombination (HDR) or homology-mediated end joining (HMEJ). [Lab plasmid ID: N213]
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepS34.EF1α
- Backbone size w/o insert (bp) 4024
- Total vector size (bp) 11302
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9-RC
-
Alt nameeRad18-Cas9-CtIP
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
-
Insert Size (bp)7278
- Promoter EF1α
-
Tag
/ Fusion Protein
- GFP-2A (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cctcagacagtggttcaaagt
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.07.15.199620 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS34.EF1α<GFP-2A-Cas9-RC was a gift from Alexandros Poulopoulos (Addgene plasmid # 207404 ; http://n2t.net/addgene:207404 ; RRID:Addgene_207404) -
For your References section:
Enhancing Precision and Efficiency of Cas9-Mediated Knockin Through Combinatorial Fusions of DNA Repair Proteins. Richardson RR, Steyert M, Khim SN, Crutcher GW, Brandenburg C, Robertson CD, Romanowski AJ, Inen J, Altas B, Poulopoulos A. CRISPR J. 2023 Oct;6(5):447-461. doi: 10.1089/crispr.2023.0036. Epub 2023 Sep 15. 10.1089/crispr.2023.0036 PubMed 37713292