pS12<ActB.mus_2A-mCh_KI-HMEJ
(Plasmid
#207407)
-
PurposeDonor template to knock in mCherry at the C-terminus of mouse ActB (β-Actin) using DSB repair by homology-mediated end joining (HMEJ). [Lab plasmid ID: TU148]
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207407 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepS12
- Backbone size w/o insert (bp) 2134
- Total vector size (bp) 4312
-
Vector typeMouse Targeting, CRISPR ; HMEJ knockin donor
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameActb
-
Alt nameβ-Actin
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2178
-
Entrez GeneActb (a.k.a. Actx, E430023M04Rik, beta-actin)
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGGTTATTGTCTCATGAGCGG
- 3′ sequencing primer ATTATACAATACTACAAGCATAAAAACGCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.07.15.199620 for bioRxiv preprint.
Please note: Addgene NGS was not able to fully resolve the poly-T region of the ActB HA-R. The plasmid was successfully used as a donor by the depositing lab.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS12<ActB.mus_2A-mCh_KI-HMEJ was a gift from Alexandros Poulopoulos (Addgene plasmid # 207407 ; http://n2t.net/addgene:207407 ; RRID:Addgene_207407) -
For your References section:
Enhancing Precision and Efficiency of Cas9-Mediated Knockin Through Combinatorial Fusions of DNA Repair Proteins. Richardson RR, Steyert M, Khim SN, Crutcher GW, Brandenburg C, Robertson CD, Romanowski AJ, Inen J, Altas B, Poulopoulos A. CRISPR J. 2023 Oct;6(5):447-461. doi: 10.1089/crispr.2023.0036. Epub 2023 Sep 15. 10.1089/crispr.2023.0036 PubMed 37713292