pRSFDuet-3C-AcrIC8
(Plasmid
#207410)
-
PurposeProtein purification vector to produce AcrIC8 in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207410 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSF Duet
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3829
- Total vector size (bp) 4069
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameT7-HRV3C-AcrIC8
-
Insert Size (bp)311
- Promoter T7
-
Tag
/ Fusion Protein
- His (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATCTCGACGCTCTCCCT
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet-3C-AcrIC8 was a gift from Yan Zhang (Addgene plasmid # 207410 ; http://n2t.net/addgene:207410 ; RRID:Addgene_207410) -
For your References section:
Exploiting activation and inactivation mechanisms in type I-C CRISPR-Cas3 for genome-editing applications. Hu C, Myers MT, Zhou X, Hou Z, Lozen ML, Nam KH, Zhang Y, Ke A. Mol Cell. 2024 Feb 1;84(3):463-475.e5. doi: 10.1016/j.molcel.2023.12.034. Epub 2024 Jan 18. 10.1016/j.molcel.2023.12.034 PubMed 38242128