Halo-ATG16L1 HRD
(Plasmid
#207537)
-
PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous ATG16L1 locus in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFastBac dual
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 9000
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag with internal PuroR cassette flanked by human ATG16L1 locus sequences
-
SpeciesH. sapiens (human), Synthetic
- Promoter Endogenous
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTTAAAAAACCTCCCACACCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-ATG16L1 HRD was a gift from Jens Schmidt (Addgene plasmid # 207537 ; http://n2t.net/addgene:207537 ; RRID:Addgene_207537) -
For your References section:
Quantitative analysis of autophagy reveals the role of ATG9 and ATG2 in autophagosome formation. Broadbent DG, Barnaba C, Perez GI, Schmidt JC. J Cell Biol. 2023 Jul 3;222(7):e202210078. doi: 10.1083/jcb.202210078. Epub 2023 Apr 28. 10.1083/jcb.202210078 PubMed 37115157