Halo-WIPI2 HRD
(Plasmid
#207544)
-
PurposeHomologous recombination donor to integrate a 3xFLAG-HaloTag at the endogenous WIPI2 locus in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFastBac dual
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 9000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag flanked by human WIPI2 locus sequences
-
SpeciesH. sapiens (human), Synthetic
- Promoter Endogenous
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTTAAAAAACCTCCCACACCTC
- 3′ sequencing primer AAA CCA CAA CTA GAA TGC AGT GA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-WIPI2 HRD was a gift from Jens Schmidt (Addgene plasmid # 207544 ; http://n2t.net/addgene:207544 ; RRID:Addgene_207544) -
For your References section:
Quantitative analysis of autophagy reveals the role of ATG9 and ATG2 in autophagosome formation. Broadbent DG, Barnaba C, Perez GI, Schmidt JC. J Cell Biol. 2023 Jul 3;222(7):e202210078. doi: 10.1083/jcb.202210078. Epub 2023 Apr 28. 10.1083/jcb.202210078 PubMed 37115157