Skip to main content

N-terminal Halo-Ku70
(Plasmid #207547)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207547 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330 Addgene #42230
  • Backbone size w/o insert (bp) 8484
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag with flanked by human Ku70 locus sequences
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2972
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer actcgagaccacgctccttc
  • 3′ sequencing primer cgtggaggctatagtgaggg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N-terminal Halo-Ku70 was a gift from Jens Schmidt (Addgene plasmid # 207547 ; http://n2t.net/addgene:207547 ; RRID:Addgene_207547)
  • For your References section:

    Single-molecule imaging reveals the kinetics of non-homologous end-joining in living cells. Mikhova M, Goff NJ, Janovic T, Heyza JR, Meek K, Schmidt JC. Nat Commun. 2024 Nov 23;15(1):10159. doi: 10.1038/s41467-024-54545-y. 10.1038/s41467-024-54545-y PubMed 39578493
Commonly requested with: