Skip to main content

ATG5 sgRNA
(Plasmid #207555)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207555 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330 Addgene #42230
  • Total vector size (bp) 8500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AACTTGTTTCACGCTATATC
  • Species
    H. sapiens (human)
  • Promoter CMV and U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer U6 forward
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATG5 sgRNA was a gift from Jens Schmidt (Addgene plasmid # 207555 ; http://n2t.net/addgene:207555 ; RRID:Addgene_207555)
  • For your References section:

    Quantitative analysis of autophagy reveals the role of ATG9 and ATG2 in autophagosome formation. Broadbent DG, Barnaba C, Perez GI, Schmidt JC. J Cell Biol. 2023 Jul 3;222(7):e202210078. doi: 10.1083/jcb.202210078. Epub 2023 Apr 28. 10.1083/jcb.202210078 PubMed 37115157