ATG16L1 sgRNA
(Plasmid
#207563)
-
PurposepX330 expressing Cas9 and a sgRNA targeting the ATG16L1 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330 Addgene #42230
- Total vector size (bp) 8500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCAGCAAGTGACATGTCGTC
-
SpeciesH. sapiens (human)
- Promoter CMV and U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer U6 forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ATG16L1 sgRNA was a gift from Jens Schmidt (Addgene plasmid # 207563 ; http://n2t.net/addgene:207563 ; RRID:Addgene_207563) -
For your References section:
Quantitative analysis of autophagy reveals the role of ATG9 and ATG2 in autophagosome formation. Broadbent DG, Barnaba C, Perez GI, Schmidt JC. J Cell Biol. 2023 Jul 3;222(7):e202210078. doi: 10.1083/jcb.202210078. Epub 2023 Apr 28. 10.1083/jcb.202210078 PubMed 37115157