pdGCas9_scr
(Plasmid
#207569)
-
PurposedGeoCas9-mediated silencing of genomic gene in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePlac/tet_dGeoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
-
gRNA/shRNA sequenceCTAGATCCGCAGTAACCCCATGGGTCATAGTTCCCCTGAGATTATCGCTGTGGTATAATGAAAGTTATACCACAGCAATGATCTCAGGGTTACTATGATAAGGGCTTTCTGCCTATAGGCAGACTGACCCGTGGCGTTGGGGATCGCCTATCGCCCGCTTTCTTCGGGCATTCCCCACTCTTAGGCG
-
SpeciesGeobacillus stearothermophilus (geocas9)
-
MutationGeoCas9(D8A,H582A)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pdGCas9_scr was a gift from John van der Oost (Addgene plasmid # 207569 ; http://n2t.net/addgene:207569 ; RRID:Addgene_207569) -
For your References section:
Characterization of the AcrIIC1 anti‒CRISPR protein for Cas9‒based genome engineering in E. coli. Trasanidou D, Potocnik A, Barendse P, Mohanraju P, Bouzetos E, Karpouzis E, Desmet A, van Kranenburg R, van der Oost J, Staals RHJ, Mougiakos I. Commun Biol. 2023 Oct 13;6(1):1042. doi: 10.1038/s42003-023-05418-5. 10.1038/s42003-023-05418-5 PubMed 37833505