3xMS-TR-100-PURO HRD
(Plasmid
#207582)
-
Purposehomologous recombination donor for the insertion of the 3xMS2-tag at the endogenous locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFastBac dual
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 9000
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xMS2-TR and 100 bp of downstream sequence followed by a PuroR and flanked by endogenous TR sequences
-
SpeciesH. sapiens (human), Synthetic
- Promoter SV40
-
Tag
/ Fusion Protein
- 3xMS2 (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTTAAAAAACCTCCCACACCTC
- 3′ sequencing primer AAA CCA CAA CTA GAA TGC AGT GA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xMS-TR-100-PURO HRD was a gift from Jens Schmidt (Addgene plasmid # 207582 ; http://n2t.net/addgene:207582 ; RRID:Addgene_207582) -
For your References section:
TCAB1 prevents nucleolar accumulation of the telomerase RNA to facilitate telomerase assembly. Klump BM, Perez GI, Patrick EM, Adams-Boone K, Cohen SB, Han L, Yu K, Schmidt JC. Cell Rep. 2023 Jun 1;42(6):112577. doi: 10.1016/j.celrep.2023.112577. 10.1016/j.celrep.2023.112577 PubMed 37267110