HaloXRCC4 sgRNA
(Plasmid
#207606)
-
PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330 Addgene #42230
- Total vector size (bp) 8500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTACTGGGTTCAGAAACAAGG
-
SpeciesH. sapiens (human)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HaloXRCC4 sgRNA was a gift from Jens Schmidt (Addgene plasmid # 207606 ; http://n2t.net/addgene:207606 ; RRID:Addgene_207606) -
For your References section:
Single-molecule imaging reveals the kinetics of non-homologous end-joining in living cells. Mikhova M, Goff NJ, Janovic T, Heyza JR, Meek K, Schmidt JC. Nat Commun. 2024 Nov 23;15(1):10159. doi: 10.1038/s41467-024-54545-y. 10.1038/s41467-024-54545-y PubMed 39578493