Skip to main content

pACYC-cdl
(Plasmid #207652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207652 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pACYCDuet1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cdl
  • Species
    Fusobacterium nucleatum
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatctcgacgctctccctta
  • 3′ sequencing primer acccctcaagacccgtttag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-cdl was a gift from Benjamin Woolston (Addgene plasmid # 207652 ; http://n2t.net/addgene:207652 ; RRID:Addgene_207652)
  • For your References section:

    Engineered bacteria titrate hydrogen sulfide and induce concentration-dependent effects on the host in a gut microphysiological system. Hayes JA, Lunger AW, Sharma AS, Fernez MT, Carrier RL, Koppes AN, Koppes R, Woolston BM. Cell Rep. 2023 Dec 26;42(12):113481. doi: 10.1016/j.celrep.2023.113481. Epub 2023 Nov 18. 10.1016/j.celrep.2023.113481 PubMed 37980564