-
PurposeControl for CybSEP2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-phSyn1(S)-FLEX-hGFP-T2A-SypeGFP-WPRE
- Backbone size w/o insert (bp) 4434
- Total vector size (bp) 5934
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGamillus
-
Alt nameCybGam
-
SpeciesOlindias
-
Insert Size (bp)813
-
MutationHistidine 86 and 159 to alanines, inserted gamillus into 339-340 of Cyb561
-
GenBank ID6JXF_A
- Promoter hSynapsin
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTGTACAGGTCTGCTTTGTATAGTTCATCCATGCCATG
- 3′ sequencing primer GATGAACTATACAAAGACTACCACAAGAAGAAGGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.01.19.524797 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn1-FLEX-CybGam-WPRE was a gift from Sung Han (Addgene plasmid # 207662 ; http://n2t.net/addgene:207662 ; RRID:Addgene_207662) -
For your References section:
Novel genetically encoded tools for imaging or silencing neuropeptide release from presynaptic terminals in vivo. Kim D-I, Park S, Ye M, Chen JY, Jhang J, Hunker AC, Zweifel LS, Palmiter RD, Han S. bioRxiv 2023.01.19.524797 10.1101/2023.01.19.524797