pET23A-Fucosidase-E1_10125-Ruminococcus_gnavus-His
(Plasmid
#207665)
-
PurposeExpresses fucosidase E1_10125 from Ruminococcus gnavus in BL21 cells, purified using His-tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePET23A
-
Backbone manufacturerMerck Millipore Novagen
- Backbone size w/o insert (bp) 3605
- Total vector size (bp) 5252
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor production of DNA, use JM109. For expression of the fucosidase, use BL21. Grow at 37 degrees Celsius until OD 0.8-1.0, induce with IPTG, then grow at room temperature.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFucosidase E1_10125
-
SpeciesRuminococcus gnavus
-
Insert Size (bp)1647
-
Mutationamino acids 34-584 were used
-
GenBank IDWP_268803839.1
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- His-tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7 Fwd TAATACGACTCACTATAGGG
- 3′ sequencing primer GATATAGTTCCTCCTTTCAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert was synthesized by GenScript.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.12.15.571923 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET23A-Fucosidase-E1_10125-Ruminococcus_gnavus-His was a gift from Robert de Vries (Addgene plasmid # 207665 ; http://n2t.net/addgene:207665 ; RRID:Addgene_207665) -
For your References section:
H7 influenza A viruses bind sialyl-LewisX, a potential intermediate receptor between species. Spruit C, Palme DI, Li T, Ríos Carrasco M, Gabarroca García A, Sweet I, Kuryshko M, Maliepaard JCL, Reiding KR, Scheibner D, Boons G-J, Abdelwhab EM, de Vries RP. bioRxiv 2023.12.15.571923 10.1101/2023.12.15.571923